H1 mtGenome

  • 5353 members

About us


Each cell of your body has a copy of the instructions that are used by the cell to maintain and duplicate itself. These instructions (the DNA) are in a single string of only four chemical compounds that are represented by the letters A, C, T, and G. The length of this string - the code - to define an entire human being - is necessarily very long. The human code has 3.165 billion letters. In letter shorthand it looks like: 

    GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCT 

and so on for 52.75 million lines. 

Half of this code comes from your mother, and half from your father, with two exceptions. One exception (only if you are male) is a section of 51 million letters that came only from your father. These are the instructions that make a male different from a female (the y-DNA). The other exception is a string of separate DNA 16,568 letters long (the mtdna). This is only passed from mother to daughter. So the ydna defines your patrilineal line and your mtdna your matrilineal line. Neither of these have anything to do with all the 'in betweens' in your family tree! 

MTDNA Results 

It is possible to 'read' the entire 16,568 letters of mtdna code (a Full Genetic Sequence, or mtFull Sequence, or FGS). Depending on which test you purchased, all, or only a few hundreds or thousands of the letter sequence may have been read. Your mtdna result looks something like this: 

HVR1 (the basic test): 16223T, 16292T, 16519C 

HVR2 (the extra test): 73G, 189G, 195C, 204C, 207A, 263G, 309.1C, 315.1C 

CR (Coding Region, only with the full sequence test): 709A 750G 1243C 1438G 2706G 3505G 4769G 5046A 5460A 7028T 8251A 8860G 8994A 11674T 11719A 11947G 12414C 12705T 14766T 15326G 15884C 

HVR1 and HVR2 are the names of sections of that 16,568 mtdna string of letters. The HVR1 section goes from letter 16001 to letter 16569. HVR2 runs from letter 1 to letter 574. The CR runs from letter 575 to 16000. Your mtdna code, in the sections you paid for, has been tested completely. However rather than list hundreds of letters, only the differences from a standard letter sequence are shown (this standard sequence is called the Cambridge Reference Sequence, or CRS). So the result above means that where letter 73 in the CRS was an A, you have a G. Where letter 16223 in the CRS was a C, you have a T. (normally C's change to T's and vice versa, and A's to G's and vice-versa - but there are, less often, other possibilities. 

Where a number like 309.1 or 309-1 appears, this means that an extra letter was inserted at that position, compared to the CRS code. 

One point of confusion - the Cambridge Reference Sequence is not the code of 'Eve'. Your results are not the changes that you have compared to the matrilineal ancestor of us all. They are instead the differences between your code and that of a lady who happened to be sequenced in Cambridge, England, in the 1990's. She was actually a member of haplogroup H, the most common in Europe. To make things even more confusing, in 2013 the standard
shifted to comparing results to mt-Eve instead of the CRS. This is called "RSRS", while CRS had been retitled "rCRS" (revised Cambridge Reference Sequence).