SEARCH FAQs
Search our FAQs below by keyword and category.
303 FAQs found. Showing page: 8 of 13
Items per page
-
I lost my kit, what do I do?
If you accidentally misplace or destroy your kit, please call our office at (713) 868-1438 or email info@familytreedna.com. Have your kit number ready and we will have a replacement kit sent to you the next day.
faq id: 463 in Order Questions Keywords: lost, replacements
-
-
-
Why are my results late?
If your results do not arrive by their expected target date, this indicates that the laboratory is having to re-run the sample to get a clear and unambiguous result. This is a normal part of the laboratory process and occurs about 10-15% of the time. The reason we sent you multiple swabs was to ensure that the lab would-be able to obtain your resu ...
faq id: 466 in Status Questions Keywords: late, results, target
-
-
Why are my results being re-run?
We will run your sample again if the first test does not provide clear and unambiguous results. This can happen for a number of reasons such as a poor scrape or unclear results on one or more markers.
faq id: 468 in Status Questions Keywords: re-run, status, results, overdue, target
-
-
What type of ancestry do I have?
The mtDNA test traced your mother's mother's mother's direct maternal line without any influences from spouses along that line (see http://www.familytreedna.com/inheritance-chart.aspx) and determined the single origin, such as Native American, African, Asian, or European. To find out about the type of origin found in your mtDNA, look at the "Haplog ...
faq id: 470 in Test Results -- mtDNA Keywords: ancestry, origins
-
How do I tell if I have Jewish ancestry?
Because Judaism is a religion and not a physical or geographical attribute that can be defined by a DNA mutation, we can only give you hints about having Jewish ancestry by comparing your results with our database and looking for matches with people that come from the same Semitic background and/or who have declared that they have Jewish ancestry o ...
faq id: 471 in Test Results -- mtDNA Keywords: jewish, ancestry, origins
-
Where did my ancestors come from?
There are two places to look for the answer to this question. The first is your haplogroup, which is identified and described for you in your mtDNA Results section. The second place to look is in our Recent Ancestral Origins database, found in the mtDNA Ancestral Origins section. In this section we list the countries of origin reported to us by oth ...
faq id: 472 in Test Results -- mtDNA Keywords: ancestors, ancestral, origins, ancestry
-
What is the CRS (Cambridge Reference Sequence)?
The CRS is the Cambridge Reference Sequence. It was the first mtDNA sequence to be completed, and all mtDNA tests are now compared to a revised edition of it. (rCRS) The entire sequence is very long, and if written out completely would be a series of letter combinations that would be much longer than this example:
ATCGATCGGCTAATTACGCGATATATATACGA ...
faq id: 473 in Test Results -- mtDNA Keywords: cambridge, reference, sequence
-
What are haplogroups?
Haplogroups are genetic population groups that identify where in the mtDNA tree of humanity you fit in. Haplogroups are what allow us to identify how large groups of people migrated starting from Africa over 60,000 years ago to different parts of the world. A description of your haplogroup is available in the mtDNA Results section: http://www.famil ...
faq id: 474 in Test Results -- mtDNA Keywords: haplogroups
-
What is my haplogroup?
You can find your haplogroup assignment in the mtDNA Results section. It is listed in the top section of the page in the chart that also lists your differences from the revised CRS. A description of your haplogroup is listed on this page as well.
For a more detailed explanation of haplogroups, please check here: http://www.familytreedna.com/under ...
faq id: 475 in Test Results -- mtDNA Keywords: haplogroups
-
What are supergroups?
Some haplogroups are the foundation for a number of other haplogroups. These "supergroups" are older, and most supergroups are not commonly found today because most of their descendents branched into other haplogroups. An example of a supergroup is R, which is the founding haplogroup preceding J, T, B, U, K, H, and V. Individuals belonging to the s ...
faq id: 476 in Test Results -- mtDNA Keywords: haplogroups, supergroups
-
Are the mtDNA haplogroups predicted or confirmed?
When we first started in 2000, haplogroup predictions were not provided; just the mutations. However, it was not very user friendly for individuals to look up the comparison data available on the web so we began providing predictions by comparison.
In 2005 we began running haplogroup tests on every sample. The haplogroup test is now part of every ...
faq id: 477 in Test Results -- mtDNA Keywords: haplogroups, predicted, confirmed
-
Don't we all go back to Africa?
Yes, all of our mtDNA lineages trace back to a common ancestor who lived in Africa 100,000 to 150,000 years ago. Some lineages migrated out of Africa about 60,000 years ago, while others remained. Lineages that historically remained in Africa include haplogroups L1, L2, and L3. Lineages that historically migrated out of Africa descend from the othe ...
faq id: 478 in Test Results -- mtDNA Keywords: African, origins
-
What do my differences from the CRS mean?
DNA is composed of four bases, represented by the first letter of their name. A=Adenine, T=Thymine C=Cytosine G=Guanine.
When an mtDNA test is performed, the lab looks at one section of your mtDNA sequence. The entire sequence is very long, and if written out completely would be a series of letter combinations that would be much longer than this ...
faq id: 479 in Test Results -- mtDNA Keywords: CRS, mutations, cambridge, reference, sequence, di
-
What are mutations? Are they bad?!?
Mutations are natural copying errors. A good analogy is to think of a copy machine which is making many copies of a page. Every once in a while it will make a mistake; an e might look more like an o, for example. This is a "mutation." If you then take that page with the o and copy it, it will pass on its "mutation" to all of its descendent copies. ...
faq id: 480 in Test Results -- mtDNA Keywords: mutations, results, differences
-
What are insertions and deletions?
In some cases you will see insertions in your mtDNA sequence. If you have an insertion after base pair 255, for example, the insertion will be listed as the base pair and .1C. In this case, a single base pair insertion has been found in your mtDNA string, noted by the .1. The nucleotide changed to cytosine (C) from guanine (G), therefore denoted wi ...
faq id: 481 in Test Results -- mtDNA Keywords: insertions, deletions, results, mutations, differe
-
Are any mutations more common than others?
There are some mutations which we see more often than others, but there is no established list of common and rare mutations. The databases might need to grow considerably before scientists are able to identify most mutations as "common" or "rare." One mutation which we find very often in a number of different haplogroups is 16519C in the HVR1 resul ...
faq id: 482 in Test Results -- mtDNA Keywords: mutations, results, commonality, differences
-
What are HVR1 and HVR2?
HVR stands for "Hypervariable Region." There are two of them in mtDNA, and they are named this way because they tend to mutate more often here than in the coding region. They also contain no genes, which means that testing these regions provides information about a person's ancestral origins on their maternal line (http://www.familytreedna.com/inhe ...
faq id: 483 in Test Results -- mtDNA Keywords: regions, hypervariable, sections, HVR, HVR1, HVR2
-
What are "low resolution matches"?
A low resolution match occurs when two individuals have exactly the same sequence in the HVR1. As long as they are in the same haplogroup, these two individuals very likely share a common ancestor at some point on the maternal line. A low resolution match has about a 50% chance of sharing a common ancestor within the last 52 generations (about 1300 ...
faq id: 484 in Test Results -- mtDNA Keywords: low, resolution, matches
-
What are "high resolution matches"?
A high resolution match occurs when two individuals have exactly the same sequence in both the HVR1 and HVR2. High resolution matches are more likely to be related within a genealogical time frame. A high resolution match has about a 50% chance of sharing a common ancestor within the last 28 generations (about 700 years).
faq id: 485 in Test Results -- mtDNA Keywords: high, resolution, matches
-
How many generations back does it trace?
Because mtDNA is passed down from the mother intact in each generation, the answer is that the test can cover both recent and distant generations. On the recent side, the mtDNA Ancestral Origins section will point towards possible countries of origin for the recent ancestors. If you have few matches, this list will not be statistically representati ...
faq id: 486 in Test Results -- mtDNA Keywords: generations, time, trace
-
Why don't I have any low resolution matches?
First, go to your User Preferences section and make sure the box next to "HVR1 matches" is checked. If it is not, check it and click "Update" at the bottom of the page. Return to your mtDNA Matches section to view the list of matches.
If you do not have any low resolution matches, you are the first person with your particular HVR1 sequence to be ...
faq id: 487 in Test Results -- mtDNA Keywords: matches, matching, low, resolution