Small Font Medium Font Large Font

mtDNA Results FAQ

What is your question? Please select below:

  1. What is the Cambridge Reference Sequence, CRS?
  2. What are haplogroups?
  3. What is my haplogroup?
  4. What are supergroups?
  5. Are mitochondrial haplogroups the same as Y-chromosome haplogroups?
  6. Are the mitochondrial haplogroups predicted or confirmed?
  7. What do these numbers and letters mean?
  8. What are mutations?
  9. What are insertions and deletions?
  10. Are any mutations more common than others?
  11. What are HVR1 and HVR2?
  12. Where do I find my ethnic origins?
  13. Where did my ancestors come from?
  14. What type of ancestry do I have (ex. Native American, African, etc.)?
  15. How do I tell if I have Jewish ancestry?
  16. How many generations back does my mtDNA test trace?
  17. Why doesn't this show me more recent ancestry and matches?
  18. What does "Unknown Oririgin" mean?
  19. Why do some of my matches show "United States?"
  20. What does the "Count" mean?
  21. Why do I match several different haplogroups or subgroups (on ancestral origins)?
  22. Why doesn't this show me percentages?
  23. Why am I matching both men and women?
  24. What are low resolution matches?
  25. What are high resolution matches?
  26. Why don't I have HVR1 matches?
  27. Why don't I have HVR1 and HVR2 combined matches?
  28. Why do I have so many matches?
  29. How do I stop receiving match notifications?
  30. Where is my certificate?
  31. Have I tested just the HVR1 or both the HVR1 and HVR2?
  32. Should I order the mtDNA Refine test?
  33. What will the mtDNA Refine test tell me?
  34. Should I order or upgrade to the mitochondrial full genomic sequence, FGS, test?
  35. What will the mtDNA Full Genomic Sequence, FGS, test tell me?
  36. What "Daughter of Eve" do I descend from?
  1. What is the Cambridge Reference Sequence, CRS?

    The CRS is the Cambridge Reference Sequence. It was the first mtDNA sequence to be completed, and all mtDNA tests are now compared to a revised edition of it.

  2. What are haplogroups?

    Haplogroups are genetic population groups. Mitochondrial haplogroups are composed of people who share a common ancestor on their direct maternal lineage. Your haplogroup tells you what branch on the mitochondrial tree of humanity you belong to.

  3. What is my haplogroup?

    You will find your haplogroup assignment in the mtDNA Results section of your myFTDNA site. If you took the mtDNA or the mtDNA Plus test then your haplogroup was determined using a panel of twenty-two Single Nucleotide Polymorphisms, SNPs. If you took the mtDNA Full Genomic Sequence, FGS, test then it was determined with your full results.

  4. What are supergroups?

    Supergroups or macro-haplogroups are the foundation for a number of other haplogroups. They represent older shared ancestors on the maternal tree. They link together many of the more common haplogroups that are found today.

  5. Are mitochondrial haplogroups the same as Y-chromosome haplogroups?

    No. While they use similar alphanumeric naming systems they are not the same. Your mitochondrial DNA haplogroup represents your direct maternal heritage. A Y-chromosome haplogroup represents a male's direct paternal heritage.

  6. Are the mitochondrial haplogroups predicted or confirmed?

    The haplogroup designation provided with mtDNA test results from Family Tree DNA and our affiliates are confirmed by a twenty-two marker panel of Single Nucleotide Polymorphisms. i.e. SNP testing.

    When we started in 2000, haplogroup predictions were not provided with test results. Looking up comparison data was not user friendly. To help our customers, we began providing comparison based predictions. In 2005, we began running a free haplogroup test on every sample. Haplogroup testing is now part of every mtDNA test we run. Our panel of SNPs is the same one that was used in Behar 2007. We are confident that this is above and beyond what anyone else offers and is consistent with our dedication to scientific standards.

  7. What do these numbers and letters mean?

    Please see:

  8. What are mutations?

    Mutations are changes to your DNA code. They are natural copying errors.

    A good analogy is to think of a copy machine which is making many copies of a page. Every once in a while it will make a mistake; an e might look more like an o, for example. This is a "mutation." If you then take that page with the o and copy it, it will pass on its "mutation" to all of its descendent copies.

  9. What are insertions and deletions?

    Insertions and deletions are types of DNA mutations. They are places in your DNA where extra nucleotides, cytosine (C), guanine (G), Adenine (A), and Thymine (T), have been added or part of the sequence has been deleted.

    Insertions are where an extra nucleotide has been added to a sequence during the copy process. A common example of an insertion is 309.1C in the second hypervariable region, HVR2. If you have an insertion after base pair 309, for example, the insertion will be listed as the base pair and .1C. In this case, a single base pair insertion has been found in your mtDNA string, noted by the .1. The nucleotide added is cytosine (C), therefore denoted with a C. The insertion then looks like this: 309.1C. If you have a two base pair insertion the results might look like this: 309.1C, 309.2C.

    A deletion is where a nucleotide has not been copied. The sequence will not have result for that place. When a deletion is found in a sequence it is represented with a minus sign. For example, "424-" means that this location, 424, isn't in the sequence.

    What do my differences from the CRS mean?

    When we test mitochondrial DNA, we compare the results with the Cambridge Reference Sequence, CRS. Your results are given as a list of the places in which your sequence is different from the CRS. These differences are often called "mutations" although they are not all necessarily mutations on your line. The CRS, after all, is also based on the mitochondrial DNA results of a person.

    DNA is composed of four bases, represented by the first letter of their name. A=Adenine, T=Thymine C=Cytosine G=Guanine

    When an mtDNA test is performed, the lab looks at one section of your mtDNA sequence. The entire sequence is 16568 nucleotides long, and if written out completely would be a series of letter combinations that would be much longer than this example:

    ATCGATCGGCTAATTACGCGATATATATACGACG

    Your results are then compared to the Cambridge Reference sequence, CRS. Where you have a different base in your sequence from the CRS a mutation is noted. Thus rather than provide you with a long letters we present your results as a much shorter list of locations on the CRS sequence and changes to the DNA or mutations.

    As an example, if the difference "16519C" is listed in your chart, then at location 16519 instead of having a T, your sequence has a C. If instead of a list of differences your chart lists "CRS," it means that your result matches the CRS across the entire HVR1 region.

  10. Are any mutations more common than others?

    There are some mutations which we see more often than others but there is no established list of common and rare mutations. The databases might need to grow considerably before scientists are able to identify most mutations as "common" or "rare." One mutation which we find very often in a number of different haplogroups is 16519C in the HVR1 result. This is a base pair in the mitochondrial which seems to have mutated many different times in human history.

  11. What are HVR1 and HVR2?

    HVR stands for hypervariable region. Hypervariable means fast changing. In mitochondrial DNA the Hypervariable Regions are the fast changing parts. There are two of them in mitochondrial DNA.

    • HVR1 runs from nucleotide 16001 to nucleotide 16569.
    • HVR2 runs from nucleotide 00001 to nucleotide 00574.

    The rest of your mitochondrial DNA sequence contains the coding region that runs from nucleotide 00575 to nucleotide 16000.

  12. Where do I find my ethnic origins?

    You may find information about your maternal origins by checking the mtDNA Ancestral Origins area on your myFTDNA site.

  13. Where did my ancestors come from?

    We provide three tools to help answer this question for your direct maternal line. While you are logged in to your myFTDNA account:

    • Check the haplogroup name and description on your mtDNA Results page. This will provide background to your historic ancestry and origins.
    • Check the mtDNA Ancestral Origins page. This includes places where your DNA motif can be found today. It is influenced by more recent migrations.
    • Use the myMaps tool to see a map you and your match's most distant known ancestors and locations.
    Don't we all go back to Africa?

    Yes, all of our mitochondrial lineages trace back to a common ancestor who lived in Africa 100,000 to 150,000 years ago. Some lineages migrated out of Africa about 60,000 years ago, while others remained. The path that our ancestors took tells a story about human history. Testing one's own and relatives' DNA can help you understand both the diversity and commonalities of your part of the human story.

  14. What type of ancestry do I have (ex. Native American, African, etc.)?

    The historic geographic origin of your direct maternal line is described under haplogroup on your results page.

  15. How do I tell if I have Jewish ancestry?

    Jewish is a religion and not a genetic attribute that can be defined by a DNA mutation. Hints to your Jewish ancestry for your direct maternal lineage are provided by our Ancestral Origins database. Check the "Comments" field there. There are four possible situations:

    • You match only people who are Jewish. You will see in the notes field Ashkenazim, Sephardim, and other historic branches. The answer here is a clear yes.
    • You match both Jews and non Jews. The answer here is not clear. A higher level of testing, the mtDNA Plus or the mtDNA Full Genomic Sequence, may eliminate matches with one group or the other.
    • You match nobody of known Jewish origins. It is highly unlikely that you have Jewish origins on this line.
    • You do not have matches in our system. This is unlikely if you have Jewish origins.

    If you need further interpretation, please contact bcg@familytreedna.com

  16. How many generations back does my mtDNA test trace?

    Mitochondrial DNA testing covers both recent and distant generations.

    To find connections in recent times it is necessary to find and test multiple people who have suspected shared ancestry. This is done by careful examination of traditional genealogical records. Making connections with people in genealogical and historic interest groups can also be helpful.

    • Matching on HVR1 means that you have a 50% chance of sharing a common maternal ancestor within the last fifty-two generations. That is about 1,300 years.
    • Matching on HVR1 and HVR2 means that you have a 50% chance of sharing a common maternal ancestor within the last twenty-eight generations. That is about 700 years.
    • Matching on the mitochondrial full genomic sequence, FGS, brings your matches into more recent times.

    Mitochondrial DNA testing at Family Tree DNA also includes haplogroup testing. Your haplogroup represents your ancestral origins thousands and tens of thousands of years ago.

  17. Why doesn't this show me more recent ancestry and matches?

    Some result motifs produce results in many countries. This is influenced by the historic migrations of peoples and the chance frequency of women with the same motif during more ancient times. Family Tree DNA offers three levels of testing. Higher levels of testing, the mtDNA Plus test and the mtDNA Full Genomic Sequence test, will show more recent and refined origins. As more people test at these levels the database and quality of information available will improve.

  18. What does "Unknown Origin" mean?

    The mtDNA Ancestral Origins database is an anonymous search of the database and lists the countries of origin reported to us by the people that you match. If these individuals did not tell us a country of origin, either because they do not know or because they did not want to share it, we entered them as "Unknown Origin." You can change the listing for your kit using the "Update Contact Information" link.

  19. Why do some of my matches show "United States?"

    The mtDNA Ancestral Origins section lists the country of origin reported to us by the people that you match. This country of origin is meant to be the country their maternal ancestor came from before any migrations to the Americas. However, some individuals instead enter the country of birth for themselves, their parents, or their most distant known ancestor. You should treat these entries as "Unknown Origin" unless your mtDNA test result indicates Native American ancestry on your maternal line.

    Why are so many different countries listed?

    If, for example, you match people from countries located throughout Europe, then you happen to have a DNA result which is found in all of these places. The same hypervariable region one motifs within a haplogroup tend to be found in a range of countries in an area. This is influenced by political boundary changes and local marriage patterns. In cultures where women often leave their family and move to another village or tribal group, a wide geographic dispersal is expected. Some results are found often enough that they have spread out throughout a very large region or a continent. Moving to a higher resolution test, the mtDNA Refine test or the mtDNA Full Genomic Sequence test, will reduce the time to a common ancestor with your matches and reduce the number of potential places of origin.

  20. What does the "Count" mean?

    When looking at the mtDNA Ancestral Origins page, the count column represents the number of people of this description in our database whom you match. For example, if under the "Country" column it says England and under the "Count" column it says 16, it means that there are 16 people who have tested with us who match your result and have reported England as their maternal country of origin. Higher counts may mean a higher chance that your ancestors come from that region, but keep in mind that more people with ancestry from some countries may have tested than from others.

  21. Why do I match several different haplogroups or subgroups (on ancestral origins)?

    Haplogroups are defined by mutations located in all three parts of mitochondrial DNA, the first and second hypervariable regions and the coding region. It is not uncommon for people with the same low resolution, HVR1, and even high resolution, HVR1 and HVR2, results to belong to different haplogroups. These matches are due to what we call "convergence," where two unrelated lineages happen to experience mutations over time that make them appear to be similar.

    Individuals in different haplogroups cannot be related in thousands or a few tens of thousands of years. This is why Family Tree DNA assures the accuracy of your haplogroup placement by performing backbone haplogroup testing on all mtDNA tests.

  22. Why doesn't this show me percentages?

    You received your mitochondrial DNA from your mother, who got it from her mother, who got it from her mother, and so on. Your results are then for a specific lineage traced back. This provides a highly accurate view of one lineage.

    Many people enjoy exploring the ancestry of other family branches by finding suitable proxies to test in their cousins and other relatives. Please see our inheritance chart for ideas.

  23. Why am I matching both men and women?

    Mitochondrial DNA is passed on by a mother to both her daughters and sons. Only females have the ability to pass it on to the next generation though. This means that both men and women can take the mtDNA test. No matter who takes the test it will still trace only the maternal line. Please see our inheritance chart for additional information.

  24. What are low resolution matches?

    An exact match on the first hypervariable region, HVR1, is sometimes called a low resolution match. When they also share the same haplogroup it indicates a possible connection. An HVR1 match has a 50% chance of a common ancestor within fifty-two generations. That is about 1,300 years.

    When they have different haplogroups it is due to convergent evolution. That is when by coincidence two different lineages mutate to look alike.

  25. What are high resolution matches?

    An exact match on both the first and second hypervariable regions, HVR1 and HVR2, is sometimes called a high resolution match. When they also share the same haplogroup it indicates a possible connection. A match on HVR1 and HVR2 has a 50% chance of a common ancestor within twenty-eight generations. That is about 700 years.

    When they have different haplogroups it is due to convergent evolution. That is when by coincidence two different lineages mutate to look alike.

  26. Why don't I have HVR1 matches?

    It may be that you have HVR1 matching turned off.

    • Login to your myFTDNA account.
    • Go to your User Preferences page.
    • Look for "When displaying matches only show..."
    • Check the box next to HVR1 matches.
    • Scroll to the bottom of the page and click Update.
    • Go to your mtDNA Matches section to view matches.

    If you do not have HVR1 matches, you are the first person with your particular HVR1 sequence to be in our database. This can mean that your result is relatively rare and that, as a result, few people have it. It can also mean that no one else from your particular lineage has happened to test yet. In both cases, the good news is that the database is constantly growing. The system will continue to search for matches for you whenever new results come in, and will notify you by email when a new match arrives.

    In the meantime, you might want to try uploading your results to the public database, www.mitosearch.org. Since this database allows people who have tested with any company to upload and compare results, being in this database increases your chances of finding a match. To upload your results to mitosearch, go to the mtDNA Matches section and click the link labeled "Click here to upload to MitoSearch.org."

  27. Why don't I have HVR1 and HVR2 combined matches?

    If you do not HVR1 matches, you will not have HVR1 and HVR2 combined matches. This is because anyone who is a high resolution match has the same HVR1 result as you and is by definition also a low resolution match. You will also not have any high resolution matches if you have not tested your HVR2 region, or if none of your low resolution matches have tested the HVR2 region. Your HVR1 matches who have tested HVR2 will have "(HVR2)" next to their name.

    It may be that you have HVR2 matching turned off.

    • Login to your myFTDNA account.
    • Go to your User Preferences page.
    • Look for "When displaying matches only show..."
    • Check the box next to HVR1 matches.
    • Scroll to the bottom of the page and click Update.
    • Go to your mtDNA Matches section to view matches.

    If you have no high resolution matches, it is because you are the only person in our database with your particular set of results for the HVR1 and HVR2 regions. As our database grows, the system will continue to look for high resolution matches for you, and will send you a notification email as soon as a matching result comes into our database.

    In the meantime, you might want to try uploading your results to the public database, www.mitosearch.org. Since this database allows people who have tested with any company to upload and compare results, being in this database increases your chances of finding a match. To upload your results to mitosearch, go to the mtDNA Matches section and click the link labeled "Click here to upload to MitoSearch.org."

  28. Why do I have so many matches?

    There are some result motifs that show a high number of matches. There are a few explanations for this.

    Many people with the same results as your ancestors lived thousands or tens of thousands of years ago. The majority of their descendents still carry their signature.

    A more recent common ancestor—within the last one or two thousand years—with this motif had many daughters who in turn had many daughters and so on so that you have many distant cousins.

    Increasing your testing level to HVR2, the mtDNA Refine upgrade, or to the mitochondrial full genomic sequence, the HVR1t0Mega or the HVR2t0Mega upgrade, will separate these two cases. This will allow you to focus on your relevant matches.

  29. How do I stop receiving match notifications?

    To stop receiving match notifications:

    • Go to the Setup Preferences section.
    • Uncheck the box next to the type of matches you do not wish to be notified of.
    • Click update to save your settings.
    • This will also remove these matches from your display in your Matches section and will remove your name from the Matches sections of the people you match. You can change this setting at any time.

  30. Where is my certificate?

    A certificate is automatically included in any original test order. You can order additional certificates using the "Order Certificates" link to the right of your name at the top of your personal page. If your certificate has not been printed yet or was only just printed, the system will not allow you to order another yet. If you transferred your mtDNA results from the Genographic Project, a certificate is not automatically mailed; you can order one using the "Order Certificates" link, or if you order any upgrade testing it will include a certificate once the results are complete.

  31. Have I tested just the HVR1 or both the HVR1 and HVR2?

    Look in the mtDNA Results section at the chart in the first section of the page. If you have tested the HVR2 region, this chart will list both HVR1 differences from the CRS and HVR2 differences from the CRS. If it lists only differences for the HVR1 region and the HVR2 region is not listed in the "Pending Lab Results" section (this section only appears when there is a test still in process at the lab), then you tested only the HVR1 region.

  32. Should I order the mtDNA Refine test?

    The mtDNA Refine test adds HVR2 results to your existing HVR1 results. You should consider ordering the mtDNA Refine test if:

    • You have an HVR1 match who you suspect you match in recent times but want additional confirmation.
    • You have many HVR1 matches who have already tested HVR2–look for (HVR2) next to their name--and you wish to refine the geographic origins.

    Note that for some of the most common HVR1 and HVR2 result motifs, HVR2 testing adds little refinement in matches. Please contact us if you need help deciding between the mtDNA Refine and mtDNA Full Genomic Sequence tests.

  33. What will the mtDNA Refine test tell me?

    The mtDNA Refine test adds the second hypervariable region, HVR2, to your test results. That is the portion of your mitochondrial DNA that runs from nucleotide 00001 to nucleotide 00574. Your matches to others in the same haplogroup on both HVR1 and HVR2 have a 50% likelihood of sharing common ancestry with you within twenty-eight generations. That is about 700 years. If you also share ancestry from the same location, the same village, town, or city, then you likely share common ancestry within recent times.

  34. Should I order or upgrade to the mitochondrial full genomic sequence, FGS, test?

    The FGS test has quickly become the standard test for individuals who want to use their mitochondrial DNA for genealogical purposes. It is also the level of testing used by scientists in newer papers. Having one's own FGS results, will allow those interested in their deeper ancestry to follow new developments.

    Taking the mitochondrial full genomic sequence, FGS, test will:

    • Be the only or final mtDNA test that you will ever need to take.
    • Improve the quality of your matches for geographic and ethnic origins.
    • Provide the highest level of confidence in a match for genealogical research.
    • Allow your assignment to a subclade within your haplogroup.
    • Help science advance knowledge of mutation rates for mitochondrial DNA and discover new branches of your haplogroup.
  35. What will the mtDNA Full Genomic Sequence, FGS, test tell me?

    The FGS, sometimes called Mega, test will:

    • Return results for all three parts of your mitochondrial DNA.
      • HVR1 – 16001 to 16569
      • HVR2 – 00001 to 00574
      • The Coding Region – 00575 to 16000
    • Improve the quality of your matches for geographic and ethnic origins.
    • Provide the highest level of confidence in a match for genealogical research.
    • Allow your assignment to a subclade within your haplogroup.
  36. What "Daughter of Eve" do I descend from?

    The "Daughters of Eve" are named after some of the haplogroups. The "Daughter of Eve" names are arbitrary, so we identify the haplogroup itself. The "Daughter of Eve" names begin with the same letter as the haplogroup name.